• All
  • Primary Antibodies
  • Conjugated Antibodies for IF
  • Conjugated Antibodies for FC
  • Secondary Antibodies
  • Antibody Labeling KitsNew
  • ELISA Kits
  • IHC Kits
  • Magnetic Cell Separation Kits
  • Cytokines & Growth Factors
  • Neutralizing/activating Antibodies
  • Nanobody-based Reagents
  • Accessory Products and Kits
  • Fusion Proteins
×
×
Host
0
Species Reactivity
0
Species Reactivity
0
Conjugate
0
Conjugate
0
Compatible Species
0
Conjugate
0

Recombinant METTL3 / METTL14 complex

Expressed In

Baculovirus

Protein Species

Human

Cat No : 31570,31970 31570

验证数据展示

  • Recombinant METTL3 / METTL14 complex, protein gel. Recombinant METTL3 / METTL14 complex was run on a 10% SDS-PAGE gel and stained with Coomassie Blue. MW: METTL3: 64.5 kDa, MW: METTL14, N-Flag: 53.3 kDa. Purity: >85%

    Recombinant METTL3 / METTL14 complex, protein gel. Recombinant METTL3 / METTL14 complex was run on a 10% SDS-PAGE gel and stained with Coomassie Blue. MW: METTL3: 64.5 kDa, MW: METTL14, N-Flag: 53.3 kDa. Purity: >85%

  • MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 μM Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 μM SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.

    MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 μM Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 μM SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.

  • MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 μM Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 μM SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.

    MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 μM Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 μM SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.

产品信息

Expressed In Baculovirus
Protein Species Human

Contents

Recombinant METTL3 / METTL14 complex is supplied in 25 mM HEPES-NaOH pH 7.5, 300 mM NaCl, 10% glycerol, 0.04% Triton X-100, and 0.5 mM TCEP.

背景介绍

N6-methylated adenine (m6A) is prevalently present in nearly all RNA types and can be found in all organisms from bacteria to humans. It preferentially appears around stop codons and within long internal exons in mammalian messager RNAs. m6A plays an important role in the efficiency of mRNA splicing, processing, translation efficiency, editing and mRNA stability. m6A also takes place in other RNA molecules, such as primary miRNA (pri-miRNAs). In mammalian cells, METTL3 (methyltransferase-like 3, also known as IME4, M6A, MT-A70) and METTL14 (methyltransferase-like 14) are two m6A methyltransferases reported to date, which both contain methyltransferase domains. These two proteins form a stable heterodimer core complex of METTL3–METTL14 that functions in cellular m6A deposition on mammalian nuclear RNAs. METTL3 is the catalytically active subunit, while METTL14 plays a structural role critical for substrate recognition.

Application Notes

This product was manufactured as described in Protein Details. Where possible, Active Motif has developed functional or activity assays for recombinant proteins. Additional characterization such as enzyme kinetic activity assays, inhibitor screening or other biological activity assays may not have been performed for every product. All available data for a given product is shown on the lot-specific Technical Data Sheet.

Protein Details

Recombinant METTL3 / METTL14 complex that includes full length human METTL3 (accession number NP_062826.2) without tag and full length METTL14 protein (accession number NP_066012.1) with an N-terminal FLAG-Tag was expressed in Sf9 cells. The molecular weights of METTL3 and METTL14 are 64.5 kDa and 53.3 kDa, respectively.

Storage

Recombinant proteins in solution are temperature sensitive and must be stored at -80°C to prevent degradation. Avoid repeated freeze/thaw cycles and keep on ice when not in storage.

Guarantee

This product is guaranteed for 6 months from date of receipt.

This product is for research use only and is not for use in diagnostic procedures.