WB result of METTL14 antibody (26158-1-AP; 1:3000; incubated at room temperature for 1.5 hours) with sh-Control and sh-METTL14 transfected Raji cells.

Various lysates were subjected to SDS PAGE followed by western blot with 26158-1-AP (METTL14 antibody) at dilution of 1:5000 incubated at room temperature for 1.5 hours.

Various lysates were subjected to SDS PAGE followed by western blot with 80790-1-RR (METTL14 antibody) at dilution of 1:5000 incubated at room temperature for 1.5 hours.

WB result of METTL14 antibody (80790-1-RR; 1:14000; incubated at room temperature for 1.5 hours) with sh-Control and sh-METTL14 transfected HeLa cells.

Immunohistochemical analysis of paraffin-embedded human colon cancer tissue slide using 80790-1-RR (METTL14 antibody) at dilution of 1:2000 (under 10x lens). Heat mediated antigen retrieval with Tris-EDTA buffer (pH 9.0).

Immunohistochemical analysis of paraffin-embedded human colon cancer tissue slide using 80790-1-RR (METTL14 antibody) at dilution of 1:2000 (under 40x lens). Heat mediated antigen retrieval with Tris-EDTA buffer (pH 9.0).

Immunohistochemical analysis of paraffin-embedded human colon cancer tissue slide using 80790-1-RR (METTL14 antibody) at dilution of 1:2000 (under 40x lens). Heat mediated antigen retrieval with Tris-EDTA buffer (pH 9.0).

Immunohistochemical analysis of paraffin-embedded human breast cancer tissue slide using KHC0145 (METTL14 IHC Kit).

Immunohistochemical analysis of paraffin-embedded human colon cancer tissue slide using KHC0145 (METTL14 IHC Kit).

Immunohistochemical analysis of paraffin-embedded mouse testis tissue slide using KHC0145 (METTL14 IHC Kit).

Various lysates were subjected to SDS PAGE followed by western blot with 80790-1-RR (METTL14 antibody) at dilution of 1:5000 incubated at room temperature for 1.5 hours. This data was developed using the same antibody clone with 80790-1-PBS in a different storage buffer formulation.

WB result of METTL14 antibody (80790-1-RR; 1:14000; incubated at room temperature for 1.5 hours) with sh-Control and sh-METTL14 transfected HeLa cells. This data was developed using the same antibody clone with 80790-1-PBS in a different storage buffer formulation.

Immunohistochemical analysis of paraffin-embedded human colon cancer tissue slide using 80790-1-RR (METTL14 antibody) at dilution of 1:2000 (under 10x lens). Heat mediated antigen retrieval with Tris-EDTA buffer (pH 9.0). This data was developed using the same antibody clone with 80790-1-PBS in a different storage buffer formulation.

Immunohistochemical analysis of paraffin-embedded human colon cancer tissue slide using 80790-1-RR (METTL14 antibody) at dilution of 1:2000 (under 40x lens). Heat mediated antigen retrieval with Tris-EDTA buffer (pH 9.0). This data was developed using the same antibody clone with 80790-1-PBS in a different storage buffer formulation.

Immunohistochemical analysis of paraffin-embedded human colon cancer tissue slide using 80790-1-RR (METTL14 antibody) at dilution of 1:2000 (under 40x lens). Heat mediated antigen retrieval with Tris-EDTA buffer (pH 9.0). This data was developed using the same antibody clone with 80790-1-PBS in a different storage buffer formulation.

Recombinant ALKBH3 protein 12.5% SDS-PAGE Coomassie staining MW: 36.9 kDa Purity: >90%

ALKBH3 dioxygenase activity 1 ug of ssDNA oligos (5’-AAAGCAG(1mA) ATTCGAAAAAGCGAAA-3’) was incubated with varying concentrations of ALKBH3 in a reaction system including 50 mM HEPES-NaOH pH 8.0, 50 uM Fe(NH4)2(SO4)2, 1 mM 2-oxoglutarate, 2 mM ascorbate and 1 mM TCEP for 30 min at 37°C. Then ssDNA oligos were annealed with equimolar of non-methylated complement strand followed by 1 ug EcoRI digestion for 45 min at 37°C. % reaction products were run on a 20% Native PAGE gel and stained by ethidium bromide.

Recombinant METTL1, His- Tag, protein gel. 12.5% SDS-PAGE gel, stained with Coomassie blue. MW: 35 kDa Purity: ≥ 95%

Recombinant METTL3 / METTL14 complex, protein gel. Recombinant METTL3 / METTL14 complex was run on a 10% SDS-PAGE gel and stained with Coomassie Blue. MW: METTL3: 64.5 kDa, MW: METTL14, N-Flag: 53.3 kDa. Purity: >85%

MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 μM Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 μM SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.

MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 μM Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 μM SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.

Recombinant METTL3 protein gel. Recombinant METTL3 protein was run on an 8% SDS-PAGE gel and stained with Coomassie Blue. MW: 65.5 kDa Purity: > 95%